About   Help   FAQ
D3Nds48-pA, D3Nds48-pB Primer Detail
Primers
  • Name
    D3Nds48-pA, D3Nds48-pB
  • Primer 1 Sequence
    CAGGGAATCCTGTAGGAAAGG
  • Primer 2 Sequence
    GGGCCCTTATGAGCCTAAGT
  • ID
    MGI:892041
  • Other IDs
    142423 (NCBI UniSTS)
Genes
D3Nds48 DNA segment, Chr 3, Nuffield Department of Surgery 48
Polymorphisms
J:39376 Denny P, et al., Diabetes. 1997 Apr;46(4):695-700
Endonuclease Gene Allele Fragments Strains
Not Specified D3Nds48 n larger C57BL/6J, C57BL/10, NOD
s smaller SPR
References
J:39376 Denny P, et al., Mapping of the IDDM locus Idd3 to a 0.35-cM interval containing the interleukin-2 gene. Diabetes. 1997 Apr;46(4):695-700
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/10/2019
MGI 6.14
The Jackson Laboratory