About   Help   FAQ
Srms-pA, Srms-pB Primer Detail
Primers
  • Name
    Srms-pA, Srms-pB
  • Primer 1 Sequence
    ACGAGAGCCAGCAGTTTCCT
  • Primer 2 Sequence
    GTCCCCTAAAAGTACATAGCA
  • ID
    MGI:799
  • Product Size
    157bp
Genes
Srms src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Polymorphisms
J:20410 Kohmura N, et al., Mol Cell Biol. 1994 Oct;14(10):6915-25
Endonuclease Gene Allele Fragments Strains
Srms b not given C57BL/6
m not given MSM/Ms
References
J:20410 Kohmura N, et al., A novel nonreceptor tyrosine kinase, Srm: cloning and targeted disruption. Mol Cell Biol. 1994 Oct;14(10):6915-25

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory