About   Help   FAQ
D17Rua3-pA, D17Rua3-pB Primer Detail
Primers
  • Name
    D17Rua3-pA, D17Rua3-pB
  • Primer 1 Sequence
    AAGGCAAGTTACATGGCGAA
  • Primer 2 Sequence
    AAACTTGTCCCGGTCAGATC
  • ID
    MGI:782
  • Other IDs
    142162 (NCBI UniSTS)
Genes
D17Rua3 DNA segment, Chr 17, Rutgers University 3
Polymorphisms
J:20144 Heine D, et al., Genomics. 1994 Sep 1;23(1):168-77
Endonuclease Gene Allele Fragments Strains
RsaI D17Rua3 b not given A.SW-H2s/Sn, B10.D2-Hc0 H2d H2-T18c/oSnJ, B10.K-H2k, P/J
c not given C3.NB-H2p
References
J:20144 Heine D, et al., Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics. 1994 Sep 1;23(1):168-77
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory