About   Help   FAQ
Ank3-pC, Ank3-pD Primer Detail
Primers
  • Name
    Ank3-pC, Ank3-pD
  • Primer 1 Sequence
    GTACACGCAAAACTGCTAGCTTG
  • Primer 2 Sequence
    CACAGAACTACAGAATTCCTCG
  • ID
    MGI:7718
  • Region Covered
    from the 3' end of the cDNA
  • Product Size
    ~125bp
Genes
Ank3 ankyrin 3, epithelial
Polymorphisms
J:34610 Bryda EC, et al., Genomics. 1996 Aug 1;35(3):425-30
Notes: The CAST/Ei amplified fragment is 2bp smaller than 101/Rl, C3H/Rl, C57BL/6 and BALB/c strains.
Endonuclease Gene Allele Fragments Strains
Ank3 b not given 101/Rl, BALB/c, C3H/Rl, C57BL/6
c not given CAST/EiJ
References
J:34610 Bryda EC, et al., Fine genetic map of mouse chromosome 10 around the polycystic kidney disease gene, jcpk, and ankyrin 3. Genomics. 1996 Aug 1;35(3):425-30

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2019
MGI 6.14
The Jackson Laboratory