About   Help   FAQ
D11Bhm105-pA, D11Bhm105-pB Primer Detail
Primers
  • Name
    D11Bhm105-pA, D11Bhm105-pB
  • Primer 1 Sequence
    GTATTGTACCACACCTTTG
  • Primer 2 Sequence
    GACAATAATTGCCTCTGAAC
  • ID
    MGI:7370
  • Product Size
    99bp
  • Other IDs
    141540 (NCBI UniSTS)
Genes
D11Bhm105 DNA segment, Chr 11, Boehm 105
References
J:25181 Nehls M, et al., YAC/P1 contigs defining the location of 56 microsatellite markers and several genes across a 3.4-cM interval on mouse chromosome 11. Mamm Genome. 1995 May;6(5):321-31
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory