About   Help   FAQ
D11Seg28-pA, D11Seg28-pB Primer Detail
Primers
  • Name
    D11Seg28-pA, D11Seg28-pB
  • Primer 1 Sequence
    CCACTCCCCTCTAACCCCG
  • Primer 2 Sequence
    CAGCTGACAGACCTTGGCCTCT
  • ID
    MGI:7201
  • Product Size
    131bp
  • Other IDs
    141802 (NCBI UniSTS)
Genes
D11Seg28 DNA segment, Chr 11, Segre 28
References
J:28409 Segre JA, et al., Positional cloning of the nude locus: genetic, physical, and transcription maps of the region and mutations in the mouse and rat. Genomics. 1995 Aug 10;28(3):549-59
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/13/2021
MGI 6.16
The Jackson Laboratory