About   Help   FAQ
D8Mit238 Primer Detail
Primers
  • Name
    D8Mit238
  • Primer 1 Sequence
    GCCCTCAGTTCTATCTCTAATACACA
  • Primer 2 Sequence
    ACTGGCTCAAGTCAGGCACT
  • ID
    MGI:707512
  • Product Size
    109
  • Other IDs
    131448 (NCBI UniSTS)
    D8Mit238 (BROAD)
  • Note
    MIT assay: MT4151
Genes
D8Mit238 DNA segment, Chr 8, Massachusetts Institute of Technology 238
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit238 a 63bp AKR/J, BALB/cJ, LP/J
b 67bp SPRET/EiJ
c 69bp NOD/MrkTac, NON/ShiLt
d 74bp CAST/EiJ
e 82bp A/J, C3H/HeJ, DBA/2J
f 110bp B6.Cg-Lepob/+
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/13/2019
MGI 6.14
The Jackson Laboratory