About   Help   FAQ
D4Mit134 Primer Detail
Primers
  • Name
    D4Mit134
  • Primer 1 Sequence
    TGCTATGGCTTCTGCTTGC
  • Primer 2 Sequence
    GAATAAACCCAACAACTTCCTCC
  • ID
    MGI:707424
  • Product Size
    150
  • Other IDs
    129909 (NCBI UniSTS)
    D4Mit134 (BROAD)
  • Note
    MIT assay: MT758
Genes
D4Mit134 DNA segment, Chr 4, Massachusetts Institute of Technology 134
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit134 a 148bp CAST/EiJ
b 150bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 162bp LP/J
d 164bp AKR/J, C3H/HeJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory