D1Mit65 Primer Detail MGI Mouse MGI:707179

D1Mit65 Primer Detail

Name

D1Mit65
Primer 1 Sequence

CTAACCCCTATACACATACTGCCC
Primer 2 Sequence

CCGTTCAGACTTGAATACAGACC
ID

MGI:707179
Product Size

180
Other IDs

D1Mit65 (BROAD)
Note

MIT assay: MPC655
Additional information: MIT STS Marker Data Files

D1Mit65

DNA segment, Chr 1, Massachusetts Institute of Technology 65

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit65	a	108bp	SPRET/EiJ
	b	180bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	182bp	DBA/2J
	d	188bp	CAST/EiJ
	e	212bp	A/J, AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt

J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit65	a	0.212kb	AEJ/Gn
	D1Mit65	s	0.108kb	M. spretus

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23