About   Help   FAQ
D10Mit186 Primer Detail
Primers
  • Name
    D10Mit186
  • Primer 1 Sequence
    CCTCCATTTAAAAATAGTGTTGTGG
  • Primer 2 Sequence
    CCCTGACCTCCACATATGCT
  • ID
    MGI:707148
  • Product Size
    128
  • Other IDs
    D10Mit186 (BROAD)
  • Note
    MIT assay: MT3359
    Additional information: MIT STS Marker Data Files
Genes
D10Mit186 DNA segment, Chr 10, Massachusetts Institute of Technology 186
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit186 a 114bp DBA/2J, LP/J
b 126bp SPRET/EiJ
c 134bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 138bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D10Mit186 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit186 c 120bp CBA/CaOlaHsd
s 125bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit186 a smaller 129P3/J
s larger SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory