About   Help   FAQ
DXMit74 Primer Detail
Primers
  • Name
    DXMit74
  • Primer 1 Sequence
    TCTCATTTAGAAACACTCTCTCATGC
  • Primer 2 Sequence
    TATTTGTTCAAGAATCAGTGTATTTGC
  • ID
    MGI:707044
  • Product Size
    138
  • Other IDs
    132180 (NCBI UniSTS)
    DXMit74 (BROAD)
  • Note
    MIT assay: MT899
Genes
DXMit74 DNA segment, Chr X, Massachusetts Institute of Technology 74
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit74 a 114bp SPRET/EiJ
b 137bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 141bp CAST/EiJ
d 143bp A/J, BALB/cJ, C3H/HeJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
DXMit74 c 131bp A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 125bp 129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
p 123bp JF1, PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory