D7Mit223 Primer Detail MGI Mouse MGI:706701

D7Mit223 Primer Detail

Name

D7Mit223
Primer 1 Sequence

ATGCACATGAGTGTGTGTATGC
Primer 2 Sequence

TCCTGTGTCTGACGCTCATC
ID

MGI:706701
Product Size

106
Other IDs

D7Mit223 (BROAD)
Note

MIT assay: MT2867
Additional information: MIT STS Marker Data Files

D7Mit223

DNA segment, Chr 7, Massachusetts Institute of Technology 223

J:43450 Haddad R, et al., Cancer Res. 1997 Oct 15;57(20):4615-23

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit223	a	smaller	129/Sv
Not Specified	D7Mit223	b	larger	C3H, C57BL/10

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit223	a	96bp	AKR/J, BALB/cJ, CAST/EiJ
	b	100bp	LP/J
	c	102bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	104bp	SPRET/EiJ

J:43450 Haddad R, et al., Genomic imprinting and Igf2 influence liver tumorigenesis and loss of heterozygosity in SV40 T antigen transgenic mice. Cancer Res. 1997 Oct 15;57(20):4615-23

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23