About   Help   FAQ
D10Mit115 Primer Detail
Primers
  • Name
    D10Mit115
  • Primer 1 Sequence
    CCATGGAATAGAAGTCTTTAAGAAGC
  • Primer 2 Sequence
    ACCTGAAGGATAAAGGGTCTTACC
  • ID
    MGI:705999
  • Product Size
    126
  • Other IDs
    116618 (NCBI UniSTS)
    D10Mit115 (BROAD)
  • Note
    MIT assay: MT704
Genes
D10Mit115 DNA segment, Chr 10, Massachusetts Institute of Technology 115
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit115 c 143bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit115 a 121bp C57BL/6J
b 127bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, DBA/2J, LP/J, NON/ShiLt
c 129bp NOD/MrkTac
d 140bp CAST/EiJ
e 143bp C3H/HeJ
f 152bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit115 a 143bp BN/aW, C3H/W, CBA/W
b 127bp 129/SvW, A.CA/W, AKR/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/12/2019
MGI 6.14
The Jackson Laboratory