About   Help   FAQ
D2Mit274 Primer Detail
Primers
  • Name
    D2Mit274
  • Primer 1 Sequence
    AGGCATTGTCAAGACCAACC
  • Primer 2 Sequence
    TACGTTTCTCAACTCATCAGTGTG
  • ID
    MGI:705682
  • Product Size
    129
  • Other IDs
    116274 (NCBI UniSTS)
    D2Mit274 (BROAD)
  • Note
    MIT assay: MT3103
Genes
D2Mit274 DNA segment, Chr 2, Massachusetts Institute of Technology 274
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit274 c 144bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit274 a 84bp SPRET/EiJ
b 126bp B6.Cg-Lepob/+, C57BL/6J
c 134bp LP/J
d 138bp A/J, AKR/J, BALB/cJ, DBA/2J, NOD/MrkTac
e 140bp NON/ShiLt
f 144bp C3H/HeJ, CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D2Mit274 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit274 c 142bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory