About   Help   FAQ
D5Mit359 Primer Detail
Primers
  • Name
    D5Mit359
  • Primer 1 Sequence
    ATTTACTTATCATTATGCCTCTGTGTG
  • Primer 2 Sequence
    TGCATTAGCCTCTGTCCCTT
  • ID
    MGI:705355
  • Product Size
    115
  • Other IDs
    130512 (NCBI UniSTS)
    D5Mit359 (BROAD)
  • Note
    MIT assay: MTH2034
Genes
D5Mit359 DNA Segment, Chr 5, Massachusetts Institute of Technology 359
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit359 a 94bp CAST/EiJ
b 96bp LP/J, NON/ShiLt
c 102bp SPRET/EiJ
d 120bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2019
MGI 6.14
The Jackson Laboratory