About   Help   FAQ
D5Mit58 Primer Detail
Primers
  • Name
    D5Mit58
  • Primer 1 Sequence
    CCTTCCACATACATAGGCAGG
  • Primer 2 Sequence
    CCTCAGTGCTGGATGGATTT
  • ID
    MGI:703946
  • Product Size
    115
  • Other IDs
    116815 (NCBI UniSTS)
    D5Mit58 (BROAD)
  • Note
    MIT assay: B578
Genes
D5Mit58 DNA segment, Chr 5, Massachusetts Institute of Technology 58
Polymorphisms
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit58 c 115bp CBA/CaOlaHsd
s 121bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/06/2019
MGI 6.14
The Jackson Laboratory