D1Mit15 Primer Detail MGI Mouse MGI:703258

D1Mit15 Primer Detail

Name

D1Mit15
Primer 1 Sequence

TCCACAGAACTGTCCCTCAA
Primer 2 Sequence

ATACACTCACACCACCCCGT
ID

MGI:703258
Product Size

160
Other IDs

D1Mit15 (BROAD)
Note

MIT assay: M146
Additional information: MIT STS Marker Data Files

D1Mit15

DNA segment, Chr 1, Massachusetts Institute of Technology 15

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit15	a	154bp	SPRET/EiJ
	b	160bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J
	c	183bp	AKR/J, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	186bp	A/J
	e	188bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit15	a	183bp	A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W
	D1Mit15	b	160bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23