About   Help   FAQ
D2Mit29 Primer Detail
Primers
  • Name
    D2Mit29
  • Primer 1 Sequence
    CGGTGACGAAGCTTCTGAG
  • Primer 2 Sequence
    CTTTGAATATGAACTCTCACCTTCC
  • ID
    MGI:703063
  • Product Size
    115
  • Other IDs
    D2Mit29 (BROAD)
  • Note
    MIT assay: d115
    Additional information: MIT STS Marker Data Files
Genes
D2Mit29 DNA segment, Chr 2, Massachusetts Institute of Technology 29
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit29 a 112bp SPRET/EiJ
b 119bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 122bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/22/2022
MGI 6.22
The Jackson Laboratory