About   Help   FAQ
D9Mit123 Primer Detail
Primers
  • Name
    D9Mit123
  • Primer 1 Sequence
    CTGTTACATCAGAAATAACGTGTGA
  • Primer 2 Sequence
    CCTCAGGGAGCCTTGAGAG
  • ID
    MGI:702275
  • Product Size
    148
  • Other IDs
    116761 (NCBI UniSTS)
    D9Mit123 (BROAD)
  • Note
    MIT assay: MT289
Genes
D9Mit123 DNA segment, Chr 9, Massachusetts Institute of Technology 123
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit123 a 145bp B6.Cg-Lepob/+
b 151bp C57BL/6J
c 155bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
d 159bp LP/J
e 167bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory