About   Help   FAQ
D2Mit254 Primer Detail
Primers
  • Name
    D2Mit254
  • Primer 1 Sequence
    GATGGTTTGTAGAAGAGTGTGTGC
  • Primer 2 Sequence
    TGTGGAACAAACATGCACAA
  • ID
    MGI:702084
  • Product Size
    194
  • Other IDs
    129134 (NCBI UniSTS)
    D2Mit254 (BROAD)
  • Note
    MIT assay: MT2201
Genes
D2Mit254 DNA segment, Chr 2, Massachusetts Institute of Technology 254
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit254 a 169bp SPRET/EiJ
b 199bp B6.Cg-Lepob/+, C57BL/6J
c 206bp A/J, BALB/cJ, DBA/2J, NON/ShiLt
d 208bp AKR/J, C3H/HeJ
e 211bp NOD/MrkTac
f 213bp LP/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory