About   Help   FAQ
D2Mit255 Primer Detail
Primers
  • Name
    D2Mit255
  • Primer 1 Sequence
    GCAAGTGTGATCTGGGTGC
  • Primer 2 Sequence
    TGAGCACACTTACACTGTGGTG
  • ID
    MGI:702083
  • Product Size
    150
  • Other IDs
    129136 (NCBI UniSTS)
    D2Mit255 (BROAD)
  • Note
    MIT assay: MT2405
Genes
D2Mit255 DNA segment, Chr 2, Massachusetts Institute of Technology 255
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit255 a 153bp B6.Cg-Lepob/+, C57BL/6J
b 160bp CAST/EiJ
c 166bp A/J, BALB/cJ, DBA/2J, NON/ShiLt
d 170bp NOD/MrkTac
e 172bp AKR/J, C3H/HeJ, LP/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory