About   Help   FAQ
D17Mit200 Primer Detail
Primers
  • Name
    D17Mit200
  • Primer 1 Sequence
    CTGTGGACAGAGGCATCTGA
  • Primer 2 Sequence
    GAAGCATTCATGCCCCTG
  • ID
    MGI:702035
  • Product Size
    123
  • Other IDs
    128015 (NCBI UniSTS)
    D17Mit200 (BROAD)
  • Note
    MIT assay: MT4800
Genes
D17Mit200 DNA segment, Chr 17, Massachusetts Institute of Technology 200
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit200 a 126bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
b 138bp SPRET/EiJ
c 148bp CAST/EiJ, NOD/MrkTac
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory