About   Help   FAQ
D3Mit77 Primer Detail
Primers
  • Name
    D3Mit77
  • Primer 1 Sequence
    TCCTGCTGACACCACCAAG
  • Primer 2 Sequence
    AGCACCTACATTTTCCGCAA
  • ID
    MGI:701899
  • Product Size
    150
  • Other IDs
    129847 (NCBI UniSTS)
    D3Mit77 (BROAD)
  • Note
    MIT assay: MPC1744
Genes
D3Mit77 DNA segment, Chr 3, Massachusetts Institute of Technology 77
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit77 a 150bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
b 164bp A/J, BALB/cJ, C3H/HeJ
c 166bp NOD/MrkTac
d 168bp NON/ShiLt
e 170bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit77 c 151bp 129P3/J, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
d 147bp DBA/2J
h 169bp C3H/HeJ
j 157bp JF1
p 127bp PWB
w 165bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/13/2019
MGI 6.14
The Jackson Laboratory