About   Help   FAQ
D2Mit458 Primer Detail
Primers
  • Name
    D2Mit458
  • Primer 1 Sequence
    GTAGTTGAGGAAGACAATTGACACA
  • Primer 2 Sequence
    AGTGCTGTCCTCTGGGCTTA
  • ID
    MGI:701816
  • Product Size
    121
  • Other IDs
    129371 (NCBI UniSTS)
    D2Mit458 (BROAD)
  • Note
    MIT assay: MTH1637
Genes
D2Mit458 DNA Segment, Chr 2, Massachusetts Institute of Technology 458
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit458 a 98bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
b 100bp CAST/EiJ
c 122bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
d 124bp SPRET/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory