About   Help   FAQ
D8Mit105 Primer Detail
Primers
  • Name
    D8Mit105
  • Primer 1 Sequence
    TGGCAAAATTCCTTCTGACC
  • Primer 2 Sequence
    CAAGCATATTTTTTAAATGAACCTACA
  • ID
    MGI:701662
  • Product Size
    122
  • Other IDs
    131311 (NCBI UniSTS)
    D8Mit105 (BROAD)
  • Note
    MIT assay: MPC651
Genes
D8Mit105 DNA segment, Chr 8, Massachusetts Institute of Technology 105
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit105 a 117bp CAST/EiJ
b 121bp B6.Cg-Lepob/+, C3H/HeJ
c 131bp AKR/J, NON/ShiLt
d 133bp BALB/cJ, DBA/2J
e 135bp LP/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/13/2019
MGI 6.14
The Jackson Laboratory