About   Help   FAQ
D14Mit98.1 Primer Detail
Primers
  • Name
    D14Mit98.1
  • Primer 1 Sequence
    GAAGACAAAACCGAAACAGG
  • Primer 2 Sequence
    CTACTCCCTCACCACAGAGTGAGTAT
  • ID
    MGI:700281
  • Product Size
    139
  • Other IDs
    127456 (NCBI UniSTS)
    D14Mit98.1 (BROAD)
  • Note
    MIT assay: D14Mit98.1
Genes
D14Mit98.1 DNA segment, Chr 14, Massachusetts Institute of Technology 98.1
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit98.1 a 146bp C3H/HeJ, DBA/2J, LP/J
b 150bp B6.Cg-Lepob/+
c 152bp BALB/cJ, C57BL/6J
d 161bp CAST/EiJ
e 164bp A/J, AKR/J, NOD/MrkTac, NON/ShiLt
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory