About   Help   FAQ
130. Kaestner et al Primer Detail
Primers
  • Name
    130. Kaestner et al
  • Primer 1 Sequence
    GCGGAGCTAACGTGGGAACTA
  • Primer 2 Sequence
    AAGAATTGAGTGCAGCTGGTC
  • ID
    MGI:6341
  • Product Size
    194bp
  • Synonyms
    130 Kaestner et al
Genes
Slc2a4 solute carrier family 2 (facilitated glucose transporter), member 4
Polymorphisms
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Slc2a4 a largest NON
b 2nd largest C57BL/6J, C57BL/10-H2g7, NOD
c 3rd largest DBA/2J, SPR
References
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/30/2021
MGI 6.16
The Jackson Laboratory