About   Help   FAQ
Spt1-pA, Spt1-pB Primer Detail
Primers
  • Name
    Spt1-pA, Spt1-pB
  • Primer 1 Sequence
    AACTTCTGGAACTGCTGATTCTG
  • Primer 2 Sequence
    GAGGCCTCATTAGCAGTGTTG
  • ID
    MGI:5634518
Genes
Mucl2 mucin-like 2
Expression
  • Assay Results
    14
References
J:124288 Kont V, et al., Modulation of Aire regulates the expression of tissue-restricted antigens. Mol Immunol. 2008 Jan;45(1):25-33

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory