About   Help   FAQ
MH1513-pA, MH1513-pB Primer Detail
Primers
  • Name
    MH1513-pA, MH1513-pB
  • Primer 1 Sequence
    TCGAAGGGAAGTGGAGAGAG
  • Primer 2 Sequence
    TTGGCCAACTCAATGTTTCG
  • ID
    MGI:5307873
Genes
Fsip1 fibrous sheath-interacting protein 1
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/03/2020
MGI 6.15
The Jackson Laboratory