About   Help   FAQ
MIP-2-pA, MIP-2-pB Primer Detail
Primers
  • Name
    MIP-2-pA, MIP-2-pB
  • Primer 1 Sequence
    CCACTCTCAAGGGCGGTCAAA
  • Primer 2 Sequence
    TACGATCCAGGCTTCCCGGGT
  • ID
    MGI:5142142
Genes
Cxcl2 chemokine (C-X-C motif) ligand 2
Expression
  • Assay Results
    6
References
J:74154 Luan J, et al., Developmental expression of two CXC chemokines, MIP-2 and KC, and their receptors. Cytokine. 2001 Jun 7;14(5):253-63

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2019
MGI 6.14
The Jackson Laboratory