About   Help   FAQ
T71086 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T71086
  • Sequence Type
    cDNA
  • ID
    MGI:4887877
  • Note
    Probe was amplified by RT-PCR (see MGI:4887876 for primer sequences). Template sequence provided by Eurexpress:
    TCAGTCTCACAGTGGCCAAGTGCTGGGACCCAACCCCTCGGAGCTACTTCACCATCCCAA
    GGGCTGACCCAGTGCGACCCATCGACCCGGCTGCCTGGCTGTCCCACACAGCAGCACTGA
    CGGGTGCCCTGCCCCGCTATGGTACGAGTCCCTGCTCCAGCGCCATCACACGCACCAGCT
    CTTCCTCACTAACCAGCTCAGTGCCTGGCGCCCCACAGCTTGAGGAGGCACCGCTGACTG
    TGAAGAGTGACATGAGTGCCATTGTCCGCGTCATGCAGTTGCCAGACTCAGGACTGGAGA
    TCCGGGACCGCATGTGGCTTAAGATCACCATTGCCAATGCTGTCATTGGGGCGGATGTGG
    TGGACTGGCTGTACACACACGTGGAGGGCTTCAAGGAGCGAAGGGAGGCAAGAAAGTATG
    CCAGCAGTATGCTGAAGCACGGTTTCCTGAGGCACACCGTGAACAAGATCACCTTTTCTG
    AGCAGTGCTACTATGTCTTTGGCGACCTGTGCAGTAACCTCGCATCCCTGAACCTCAACA
    GTGGCTCCAGTGGAGCCTCAGATCAGGACACACTGGCCCCACTGCCCCACCCATCAGTAC
    CCTGGCCCTTGGGTCAAGGCTACCCCTACCAGTACCCAGGACCCCCGCCCTGCTTCCCGC
    CTGCTTACCAGGACCCTGGCTTCAGCTGCGGCAGCGGCAGTGCTGGGAGCCAGCAGAGTG
    AAGGGAGCAAGAGCAGTGGGTCCACACGGAGCAGCCATCGGACCCCAGGCCGAGAGGAGC
    GCCGGGCAACTGGAGCTGGGGGTAGTGGCAGTGAATCAGACCACACAGTACCAAGTGGGT
    CTGGTAGCACCGGCTGGTGGGAGCGGCCTGTCAGCCAGCTTAGCCGTGGCAGTAGCCCTC
    GAAGTCAGGCTTCAGCTGTTGCCCCAGGGCTCCCCCCACTGCACCCCCTTACAAAGGCCT
    ATGCAGTAGTGGGTGGGCCACCTGGAGGGCCACCCGTCCGGGAGCTGGCTGCTGTCCCTC
    CAGAACTTACAGGTAGCCGCCAGTCCTTCCAAAAGGCCATGGGAAACCCCTGTGAGTTCT
    TTGTGGACATCATGTGATGATCAACCAATGTCTTCAGCGCTGCCTGTGGCTGAGTCTGTG
    CTCCTGCTG
  • Synonyms
    GUDMAP:14627 probe, GUDMAP:14628 probe, maprobe:6678, Qiu31
Source
  • Species
    mouse, laboratory
Genes
Dvl1 dishevelled segment polarity protein 1
Expression
  • Assay Results
    84
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:177549 Willnow T, et al., The European renal genome project: an integrated approach towards understanding the genetics of kidney development and disease. Organogenesis. 2005 Apr;2(2):42-7
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582
J:252208 Yu P, et al., Mutations in WNT10B Are Identified in Individuals with Oligodontia. Am J Hum Genet. 2016 Jul 7;99(1):195-201

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory