About   Help   FAQ
g00607 Probe Detail
Nucleotide
Probe/Clone
  • Name
    g00607
  • Sequence Type
    cDNA
  • ID
    MGI:4884936
  • Note
    Probe sequence provided by the Brain Gene Expression Map (BGEM) database:
    NNACAGGAAACAGACATATGACATGNATTACGAATTTAATACGACTCACTATAGGGAATT
    TGGCCCTCGAGGCCAAGAATTCGGCACGAGGGTTTTCTCGCGGATAGCCAGGGCGTCGTT
    CAGGAGGTTAGCTGCATCTTTATACTTGTTCTGATCCCTGTACACCAGAGGCCAAGATGT
    TGAGCATGGTAGCCACATCGGGGTGGTCGTGGCCGGAAGTCTTCTCCAGATCCTCCAGGG
    CCTGCTTGCAGAGTGGCACCGCCACCTCGTAACGCCCCTGTGAAGCATACTGGATCACCA
    AGTTGTGGAGCGTGCGCAGCCTTGCAGGGATCTCGTAGCCGCCCTGCTGGGCGGCGGCCG
    CAAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAAC
    GTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTNGNCCNTTTNGGNNNAANCAAAANN
    NNNNNNNNNNNNNNNNNNNAAAANNNNNNNNNNNNNNCNNNNNNTNANNNNNNNNNNNNN
    NNNAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Source
  • Species
    mouse, laboratory
  • Age
    postnatal day 0
Genes
Klc1 kinesin light chain 1
Expression
  • Assay Results
    43
References
J:162220 Magdaleno S, et al., BGEM: an in situ hybridization database of gene expression in the embryonic and adult mouse nervous system. PLoS Biol. 2006 Apr;4(4):e86

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory