About   Help   FAQ
MOR112-1-pA, MOR112-1-pB Primer Detail
Primers
  • Name
    MOR112-1-pA, MOR112-1-pB
  • Primer 1 Sequence
    CAACCGTGTGTGCATTCTTC
  • Primer 2 Sequence
    GCTTCACTTGCTGGTTCCTC
  • ID
    MGI:4835755
Genes
Olfr790 olfactory receptor 790
Expression
  • Assay Results
    12
References
J:162854 Rodriguez-Gil DJ, et al., Chromosomal location-dependent nonstochastic onset of odor receptor expression. J Neurosci. 2010 Jul 28;30(30):10067-75

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/13/2019
MGI 6.14
The Jackson Laboratory