About   Help   FAQ
Trpm6-pE, Trpm6-pF Primer Detail
Primers
  • Name
    Trpm6-pE, Trpm6-pF
  • Primer 1 Sequence
    TGCCTAGAGGGCACAGTGCATAAT
  • Primer 2 Sequence
    TAGCATCTTCATGCAGAACCGGGA
  • ID
    MGI:4821984
Genes
Trpm6 transient receptor potential cation channel, subfamily M, member 6
Expression
  • Assay Results
    7
References
J:161879 Asai Y, et al., A quantitative analysis of the spatiotemporal pattern of transient receptor potential gene expression in the developing mouse cochlea. J Assoc Res Otolaryngol. 2010 Mar;11(1):27-37

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory