About   Help   FAQ
Spint1-pA, Spint1-pB Primer Detail
Primers
  • Name
    Spint1-pA, Spint1-pB
  • Primer 1 Sequence
    GGTCTTCGGAGGGAAGGC
  • Primer 2 Sequence
    GCAGATGACCAGAAATACAGCAATA
  • ID
    MGI:4821571
  • Note
    These primers were used for TaqMan PCR analysis; the probe used was MGI:4821559.
Genes
Spint1 serine protease inhibitor, Kunitz type 1
Expression
  • Assay Results
    45
References
J:157446 Camerer E, et al., Local protease signaling contributes to neural tube closure in the mouse embryo. Dev Cell. 2010 Jan 19;18(1):25-38

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory