About   Help   FAQ
Ftcd-pE, Ftcd-pF Primer Detail
Primers
  • Name
    Ftcd-pE, Ftcd-pF
  • Primer 1 Sequence
    GAAGCCCGAAAGGAGTGAAGA
  • Primer 2 Sequence
    GGGCCACTTAAGATAGGTAAGGAATACT
  • ID
    MGI:3846718
Genes
Ftcd formiminotransferase cyclodeaminase
Expression
  • Assay Results
    4
References
J:147857 Liu SP, et al., Glycine N-methyltransferase-/- mice develop chronic hepatitis and glycogen storage disease in the liver. Hepatology. 2007 Nov;46(5):1413-25

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory