About   Help   FAQ
Atpi-pA, Atpi-pB Primer Detail
Primers
  • Name
    Atpi-pA, Atpi-pB
  • Primer 1 Sequence
    GTGTCTGGGGTATGAAGGTC
  • Primer 2 Sequence
    CTTCGAATGGTGGTCAATCT
  • ID
    MGI:3691781
Genes
Atpif1 ATPase inhibitory factor 1
Expression
  • Assay Results
    10
References
J:113222 Li XY, et al., Transcription profile during maternal to zygotic transition in the mouse embryo. Reprod Fertil Dev. 2006;18(6):635-45

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory