About   Help   FAQ
Nmyc-pC, Nmyc-pD Primer Detail
Primers
  • Name
    Nmyc-pC, Nmyc-pD
  • Primer 1 Sequence
    AAGGCGGTAACCACTTTCACG
  • Primer 2 Sequence
    CTGGAACAACACTTTTGAGGGG
  • ID
    MGI:3654050
Genes
Mycn v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived
Expression
  • Assay Results
    2
References
J:108109 Oxburgh L, et al., TGFbeta superfamily signals are required for morphogenesis of the kidney mesenchyme progenitor population. Development. 2004 Sep;131(18):4593-605
J:198233 Wang Y, et al., Transcription factor Sox11 is essential for both embryonic and adult neurogenesis. Dev Dyn. 2013 Jun;242(6):638-53

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory