About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 7:30-8:30 AM EDT Thursday, May 28.
1494-pA, 1494-pB Primer Detail
Primers
  • Name
    1494-pA, 1494-pB
  • Primer 1 Sequence
    GCTAATGCCAACCTCAGCAAA
  • Primer 2 Sequence
    AAGGAAAGCGGAGGCAAGAT
  • ID
    MGI:3625539
  • Product Size
    91bp
Genes
Slc22a6 solute carrier family 22 (organic anion transporter), member 6
Expression
  • Assay Results
    38
References
J:101679 Deltagen Inc, NIH initiative supporting placement of Deltagen, Inc. mice into public repositories. MGI Direct Data Submission. 2005;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/12/2020
MGI 6.15
The Jackson Laboratory