About   Help   FAQ
302-pA, 302-pB Primer Detail
Primers
  • Name
    302-pA, 302-pB
  • Primer 1 Sequence
    CAAGGGCTATGTGCTCTTTTGTG
  • Primer 2 Sequence
    GGCTCGGACCACTCTAAAGATG
  • ID
    MGI:3624739
Genes
S1pr4 sphingosine-1-phosphate receptor 4
Expression
  • Assay Results
    38
References
J:101679 Deltagen Inc, NIH initiative supporting placement of Deltagen, Inc. mice into public repositories. MGI Direct Data Submission. 2005;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory