About   Help   FAQ
D8ertd233e-pA, D8ertd233e-pB Primer Detail
Primers
  • Name
    D8ertd233e-pA, D8ertd233e-pB
  • Primer 1 Sequence
    TCTAATAATTGCTAACCAATAAG
  • Primer 2 Sequence
    AGGACAGCCAAGGCTATACAGAG
  • ID
    MGI:3615239
Genes
Rbm34 RNA binding motif protein 34
Expression
  • Assay Results
    2
References
J:103446 McKee AE, et al., A genome-wide in situ hybridization map of RNA-binding proteins reveals anatomically restricted expression in the developing mouse brain. BMC Dev Biol. 2005 Jul 20;5:14

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/15/2019
MGI 6.14
The Jackson Laboratory