About   Help   FAQ
mds-real-ex14, mds-real-ex15 Primer Detail
Primers
  • Name
    mds-real-ex14, mds-real-ex15
  • Primer 1 Sequence
    GGGGACTCAATGGACAGCTA
  • Primer 2 Sequence
    TATCTGCAGCTGGAATGCTG
  • ID
    MGI:3611282
Genes
Dchs1 dachsous cadherin related 1
Expression
  • Assay Results
    10
References
J:102257 Rock R, et al., Expression of mouse dchs1, fjx1, and fat-j suggests conservation of the planar cell polarity pathway identified in Drosophila. Dev Dyn. 2005 Nov;234(3):747-55

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/22/2020
MGI 6.16
The Jackson Laboratory