About   Help   FAQ
Duox1/2-pA, Duox1/2-pB Primer Detail
Primers
  • Name
    Duox1/2-pA, Duox1/2-pB
  • Primer 1 Sequence
    AAGTTTGAGGTGTCAGTGCTGGTAG
  • Primer 2 Sequence
    GCAGAGAGTTGAAAAAAGGGCTC
  • ID
    MGI:3052723
  • Product Size
    400bp
Genes
Duox1 dual oxidase 1
Duox2 dual oxidase 2
Expression
  • Assay Results
    12
References
J:83395 Sandell LL, et al., Gatm, a creatine synthesis enzyme, is imprinted in mouse placenta. Proc Natl Acad Sci U S A. 2003 Apr 15;100(8):4622-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory