About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 7:30-8:30 AM EDT Thursday, May 28.
P3, P4 Primer Detail
Primers
  • Name
    P3, P4
  • Primer 1 Sequence
    GCTGTGGATGAGATGAATGG
  • Primer 2 Sequence
    GGTTAGTGAGGTGAGCCTG
  • ID
    MGI:2682834
  • Product Size
    402bp
Genes
Pabpc1 poly(A) binding protein, cytoplasmic 1
Pabpc2 poly(A) binding protein, cytoplasmic 2
Expression
  • Assay Results
    10
References
J:51694 Paynton BV, RNA-binding proteins in mouse oocytes and embryos: expression of genes encoding Y box, DEAD box RNA helicase, and polyA binding proteins. Dev Genet. 1998;23(4):285-98

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory