About   Help   FAQ
Ftcd-pC,Ftcd-pD Primer Detail
Primers
  • Name
    Ftcd-pC,Ftcd-pD
  • Primer 1 Sequence
    TAGTCCCCGATAGTGGACCA
  • Primer 2 Sequence
    GGCATCAGCATCCACCAA
  • ID
    MGI:2674414
Genes
Ftcd formiminotransferase cyclodeaminase
Expression
  • Assay Results
    2
References
J:80501 Gitton Y, et al., A gene expression map of human chromosome 21 orthologues in the mouse. Nature. 2002 Dec 5;420(6915):586-90

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory