About   Help   FAQ
myosin9b 11F/11R Primer Detail
Primers
  • Name
    myosin9b 11F/11R
  • Primer 1 Sequence
    ACTGAGAGCCTGCTGGAGGAGA
  • Primer 2 Sequence
    GATGCCAGTTCGGGGATGTTAG
  • ID
    MGI:2669601
  • Region Covered
    nucleotides 5986-6007 and 6368-6389
Genes
Myo9b myosin IXb
Expression
  • Assay Results
    2
References
J:58743 Grewal PK, et al., Cloning of the murine unconventional myosin gene Myo9b and identification of alternative splicing. Gene. 1999 Nov 29;240(2):389-98

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/06/2019
MGI 6.14
The Jackson Laboratory