About   Help   FAQ
BDNF-pA, BDNF-pB Primer Detail
Primers
  • Name
    BDNF-pA, BDNF-pB
  • Primer 1 Sequence
    GAAGAGCTGCTGGATGAGGAC
  • Primer 2 Sequence
    CGAGTTCCAGTGCCTTTTGTC
  • ID
    MGI:2656236
  • Product Size
    417bp
Genes
Bdnf brain derived neurotrophic factor
Expression
  • Assay Results
    15
References
J:74160 Ivanova T, et al., Pre- and postnatal expression of brain-derived neurotrophic factor mRNA/protein and tyrosine protein kinase receptor B mRNA in the mouse hippocampus. Neurosci Lett. 2001 Jul 6;307(1):21-4

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory