About   Help   FAQ
Mpg-pC, Mpg-pD Primer Detail
Primers
  • Name
    Mpg-pC, Mpg-pD
  • Primer 1 Sequence
    CAGAGCAGCAGCAGACCCC
  • Primer 2 Sequence
    CCTTGAGGGAACGGCCGACAGTGC
  • ID
    MGI:2179073
  • Product Size
    470bp
Genes
Mpg N-methylpurine-DNA glycosylase
Expression
  • Assay Results
    25
References
J:74061 Kim NK, et al., Spatial expression of a DNA repair gene, N-methylpurine-DNA glycosylase (MPG) during development in mice. Anticancer Res. 2000 Sep-Oct;20(5A):3037-43

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory