About   Help   FAQ
Ms10i-primerF,Ms10i-primerR Primer Detail
Primers
  • Name
    Ms10i-primerF,Ms10i-primerR
  • Primer 1 Sequence
    GCACACATCTCTAATCCCAGT
  • Primer 2 Sequence
    CCTCTATGTGTATGTAGCCCTG
  • ID
    MGI:2153027
Genes
Ms10i minisatellite 10i detected by probe MMS10
Polymorphisms
J:69106 Bois PR, et al., Mamm Genome. 2001 Feb;12(2):104-11
Endonuclease Gene Allele Fragments Strains
Ms10i a not given FVB/NJ, SWR/J
b not given A/J, BALB/cJ, C3H/J, C57BL/6J, CBA/J, DBA/2J
j not given SJL/J
k not given AKR
p not given P/J
s not given SPRET/EiJ
References
J:69106 Bois PR, et al., Length of uninterrupted repeats determines instability at the unstable mouse expanded simple tandem repeat family MMS10 derived from independent SINE B1 elements. Mamm Genome. 2001 Feb;12(2):104-11

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/04/2020
MGI 6.14
The Jackson Laboratory