About   Help   FAQ
Due to maintenance, access to MGI maybe intermittent on Thu, May 23 at 7:30 AM ET.
Epo-pA, Epo-pB Primer Detail
Primers
  • Name
    Epo-pA, Epo-pB
  • Primer 1 Sequence
    GTGTGGGAGAAAATATCAGAGACA
  • Primer 2 Sequence
    AATGTCATTCCCTATCCTCCCT
  • ID
    MGI:201
  • Product Size
    159-171bp
  • Note
    Amplifies a short tandem repeat in intron 3.
Genes
Epo erythropoietin
Polymorphisms
J:16406 Maichele AJ, et al., Mamm Genome. 1994 Jan;5(1):15-8
Notes: Products were amplified by PCR then separated on a 6% denaturing polyacrylamide gel.
Endonuclease Gene Allele Fragments Strains
Epo a 159.0bp AKR/J
b 163.0bp A/J, BALB/c, C3H/HeJ, C57BL/6J, C57BL/10, C57L/J, DBA/2J, DF
m 171.0bp CASA/RkJ, MOLD/RkJ
References
J:16406 Maichele AJ, et al., The gamma phosphorylase kinase gene, Phkg, maps to mouse chromosome 5 near Gus. Mamm Genome. 1994 Jan;5(1):15-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/14/2019
MGI 6.14
The Jackson Laboratory